| D | 106842 | 157 | Collect/Generate/Validate Field and Lab Data | Analyze HRPP spring Chinook salmon smolt samples | Background description provided for context. Work conducted under this contract is for laboratory analysis of collected samples.
Fish Collections:
Sampling for this project will take place in April 2013. 300 Hood River origin fish from each facility (RBH, PFF, MF) will be collected by dip-net, individually anesthetized in a buffered solution of 0.05% tricaine methanesulfonate (MS-222, Argent Chemical Laboratories, Redmond, WA), weighed to the nearest 0.1g and measured for fork length to the nearest 1.0 mm. Sex and state of maturation will be determined by visual observation.
Under this UW contract: Carcasses from 50 fish from each population will be analyzed for whole body lipid via the method of Beckman et al. (unpublished) via the inverse of body moisture.
Gill Na+/K+-ATPase activity:
Gill tissue will be sampled from 50 fish from each population. Filaments from 3 gill arches will be placed in a solution of sucrose, EDTA, and imidazole according to methods described by Zaugg (1982) and then frozen on dry ice and stored at -80 C.
Under this UW contract: Gill Na+/K+-ATPase activities will be measured using the method of McCormick (1993) and all values are reported in units of mmole PO4 x mg pro -1 x hr -1.
Minijack screening
Sex and state of maturational development will be visually assessed as follows: Immature female fish are identified by the gonad having an anterior thickening with a granular appearance. Immature male fish are identified by the gonad having a thin, clear, threadlike appearance with a diameter less than approximately 0.5 mm throughout the entire length. Precociously maturing males are identified by the gonad being opaque and having an anterior thickening of greater than approximately 1.0-1.5 mm (depending on date) and a smooth surface texture. It should be noted that these visual assessments provide preliminary estimates but, confirmation by 11-KT analysis at this early stage of development is required. Blood samples will be collected from the severed caudal vessel into heparinized Natelson tubes (VWR Scientific), centrifuged for 3 minutes at 3000 G, and stored frozen at -80C.
Under this UW contract: Plasma 11-KT levels will determined in all male samples using an enzyme-linked immunosorbant assay (ELISA) according to the method of Cuisset et al. (1994). Approximately 150 males per population = 450 samples analyzed for 11-KT.
References
Cuisset, B., P. Pradelles, D.E. Kime, E.R. Kuhn, P. Babin, F. Le Menn. 1994. Enzyme immunoassay for 11-ketotestosterone using acetylcholinesterase as label. Application to the measurement of 11-ketotstosterone in plasma of Siberian sturgeon. Comparative Biochemistry and Physiology 108:229-241.
Larsen, D.A., B. R. Beckman, K. A. Cooper, D. Barrett, M. Johnston, P. Swanson, and W. W. Dickhoff. 2004. Assessment of high rates of precocious male maturation in a spring Chinook salmon supplementation hatchery program. Transactions of the American Fisheries Society 133:98-120.
McCormick, S. D. 1993. Methods for nonlethal gill biopsy and measurement of Na+/K+-ATPase activity. Canadian Journal of Fisheries and Aquatic Science 50:656-658.
Zaugg, W. S. 1982. Some changes in smoltification and seawater adaptability of salmonids resulting from environmental and other factors. Aquaculture 28:143–151. | $19,000 | 19.00% | 12/01/2012 | 11/30/2013 |
| E | 106844 | 157 | Collect/Generate/Validate Field and Lab Data | Analyze HRPP steelhead samples | All HRPP Steelhead samples will be collected under a sibling contract with NOAA fisheries and analyzed under this contract through the University of Washington
Testis histology, plasma hormone, tissue mRNA and gill Na+/K+ATPase analyses
Histological analysis of stage of spermatogenesis will performed on all testis samples collected in May to identify fish that had initiated puberty for the following spring. Fixed testis tissue will be dehydrated through a graded series of ethanol and embedded in paraffin. Sections will be cut at 4 microns on a standard rotary microtome and stained in hematoxylin and eosin. Stages of spermatogenesis will be determined according to the most advanced stage of germ cell present in the sections (Campbell et al. 2003, Schulz et al. 2011). Testes that contain only isolated Type A undifferentiated spermatogonia are classified as prespermatogenic or prepubertal. Stages of spermatogenesis are defined as follows: stage I, the presence of mitotic Type A differentiated spermatogonia; stage II, presence of late B spermatogonia and/or primary spermatocytes; stage III, presence of all meiotic stages of germ cells (primary and secondary spermatocytes and spermatids); stage IV, presence of all stages of germ cells and spermatozoa in tubules; stage V, mainly spermatozoa present in tubules.
Plasma 11-ketotestosterone (11-KT) will be determined using a specific enzyme immunoassay (Cuissett et al. 1994). Prior to assay plasma samples were heat treated according to Schulz et al. (1994).
Quantitative real time RT-PCR will be performed as described previously (Campbell et al. 2006). Total RNA will be isolated from frozen testes, whole pituitaries or gill tissue using using QiagenÕs RNeasy Plus spin column kit (Qiagen, Valencia, CA). Integrity of the RNA will be verified by an optical density (OD) absorption ratio OD 260 nm/ OD 280 nm >1.9 and quantified by spectrophotometry at 260 nm using a nanodrop ND-1000 (NanoDrop Technologies, Wilmington, DE). Total RNA will be diluted with nuclease free water to 10.0 ng/ml and transcribed (15 ml) using Superscript II RNase H- reverse transcriptase (Invitrogen, Carlsbad, CA). For pituitaries and testes the reverse transcription (RT) reaction conditions are as follows: 3.0 ml of 5x buffer, 1.5 ml of 0.1 M dTT, 0.75 ml of dNTPs (stock of 10 mM each dCTP, dGTP, dTTP and dATP; Promega, Madison WI), 0.225 ml random hexamer (500 ng/ml stock; Promega), 0.1875 ml Superscript II RNase H- (200 U/ml), 0.3 ml RNase inhibitor (20 U/ml; Promega), sterile distilled deionized (dd) H20 (6.0375 ml) and 3.0 ml of template. The temperature profile for both the RT reactions is: 25¡C for 10 min, 48¡C for 60 min and 95¡C for 10 min, followed by a 4¡C incubation. RT reactions were diluted with equal volumes of RNAse-free water for a final 1:2 dilution prior to measurement in real-time quantitative RT-PCR assays.
Probes and primers for real-time quantitative RT-PCR assays were designed according to sequence data using Primer Express software from ABI. When possible intron/exon splice junctions were used in primer design to avoid potential signal from contaminating genomic DNA. Probe and primer sequence for FSH beta, LH beta, anti-Mullerian hormone (AMH) and a housekeeping gene, elongation factor alpha (ef1a) are presented in Table 1.
Table 1. Probe and primer design for quantitative real time RT-PCR assays.
Target Forward Primer 5'-3' Probe 5'-3' Reverse Primer 5'-3'
FSH beta AGGACTGTCACGGAAGCATCA 6FAM-TCACCACCTGCGCCGGCC-BHQ1 GTTCAGGTCCGTTGTTTCGC
LH beta GTCACCAAGGAGCCGGTTTT 6FAM-AGCCCATTTTCCACCGTGTACCAGC-BHQ1 GTCCCGGTAGGTGCACACA
Elf1alpha GAGATGGGCAAGGGCTCTTT6FAM-TCAGCTTGTCCAGCACCCAGGCA-BHQ1 TGATACCACGCTCCCTCTCA
AMH CATCTACAACTGCCAGGGAGTCT 6FAM-CAGCTTTCCCCTGACCAACGGGAA-BHQ1 CTGTTAAGCAGGATAGCATGGT
BHQ1: 3' quencher (non-fluorescent)
6FAM: 5' fluorescent reporter dye
For each transcript measured a total RNA sample will be analyzed without RT reaction to test for DNA contamination. All assays will be run on an ABI 7900 HT Fast Real-Time PCR System using 384 well plates and ABI's Universal PCR MasterMix Reagent. PCR efficiency for each transcript will be measured using a serial dilution of a testis or pituitary RNA sample from within the experiment as a reference. Standard curve dilutions are run in triplicate while samples are not replicated. Reaction conditions are as follows for 12 ml PCRs: 6.0 ml of Universal PCR MasterMix (ABI), 0.22 ml of forward primer (45 mM stock), 0.22 ml of reverse primer (45 mM stock), 0.24 ml of probe (10 mM stock), 2.32 ml dd H20 and 3.0 ml of diluted RT reaction. Cycling parameters were: 50 C for 2 min, 95 C for 10 min and 40-45 cycles of 95 C for 15 sec followed by 60 C for 1 min.
Transcript levels are calculated using the serially diluted total RNA sample standard curve and efficiency corrected by housekeeper (ef1a) using the method from Pierce et al. (2004). Template RNA concentrations are quantified using a NanoDrop ND-1000 (NanoDrop Technologies, Wilmington, DE) and the samples will be diluted to the same concentration (10.0 ng/ml) prior to the RT reaction. All samples for each gene are contained within one plate.
Gill Na+/K+-ATPase activities will be measured using the method of McCormick (1993) and all values are reported in units of mmole PO4 x mg pro -1 x hr -1.
Campbell, B., J.T. Dickey, and P. Swanson. 2003. Endocrine changes during puberty onset in male spring Chinook salmon, Oncorhynchus tshawytscha. Biology of Reproduction 69: 2109-2117.
Campbell, B., J.T. Dickey, B. Beckman, G. Young, A. Pierce, H. Fukada, and P. Swanson. 2006. Previtellogenic oocyte growth in salmon: relationships among body growth, plasma insulin-like growth factor-1, estradiol 17-beta, follicle-stimulating hormone and expression of ovarian genes of insulin-like growth factors, steroidogenic-acute regulatory protein and receptors for gonadotropins, growth hormone and somatolactin. Biology of Reproduction 75: 34-44.
Cuisset, B., P. Pradelles, D.A. Kime, E.R. Kuhn, P. Babin, and F. LeMenn. 1994. Enzyme immunoassay for 11-ketotestosterone in plasma of Siberian sturgeon. Comparative Biochemistry and Physiology 108:229-241.
McCormick, S. D. 1993. Methods for nonlethal gill biopsy and measurement of Na+/K+-ATPase activity. Canadian Journal of Fisheries and Aquatic Science. 50:656-658.
Pierce, A.L., J.T. Dickey, D.A. Larsen, H. Fukada, P. Swanson, and W.W. Dickhoff. 2004. A quantitative real-time RT-PCR assay for salmon IGF-I mRNA, and its application in the study of GH regulation of IGF-I gene expression in primary culture of salmon hepatocytes. General and Comparative Endocrinology 135:401-411.
Schulz, R.W., L.R. de Franca, J.-J. Lareyre, F. LeGac, H. Chiarini-Garcia, R. H. Nobrega, and T. Miura. 2010. Spermatogenesis in fish. General and Comparative Endocrinology 165:390-411.
Schulz, R.W., L. van der Corput, J. Janssen-Dommerholt, and H. J. Th. Goos. 1994. Sexual steroids during puberty in male African catfish (Clarius gariepinus): serum levels and gonadotropin-stimulated testicular secretion in vitro. Comparative Biochemistry and Physiology B 164:195-205. | $55,000 | 55.00% | 12/01/2012 | 11/30/2013 |
Help
Mitigation work
Reporting
Funding
Search
Log in
SOW Report
